Using genetic codes#

Note

Alpha Release of the New GeneticCode API

We are pleased to announce an alpha release of our new GeneticCode API. This version can be accessed by specifying the argument new_type=True in the get_code() function.

Please be aware that this alpha release has not been fully integrated with the library. Users are encouraged to explore its capabilities but should proceed with caution!

Selecting codes in methods that support them#

In cases where a cogent3 object method has a gc argument, you can just use the number under “Code ID” column.

For example, I’ve created a partial codon in "s1"

from cogent3 import make_aligned_seqs

data = {
    "s1": "GCTCATGCCAGCTCTTTACAGCATGAGAACA--AGT",
    "s2": "ACTCATGCCAACTCATTACAGCATGAGAACAGCAGT",
    "s3": "ACTCATGCCAGCTCATTACAGCATGAGAACAGCAGT",
    "s4": "ACTCATGCCAGCTCATTACAGCATGAGAACAGCAGT",
    "s5": "ACTCATGCCAGCTCAGTACAGCATGAGAACAGCAGT",
}

nt_seqs = make_aligned_seqs(data=data, moltype="dna")
nt_seqs

	0
s2	ACTCATGCCAACTCATTACAGCATGAGAACAGCAGT
s1	G.........G...T................--...
s3	..........G.........................
s4	..........G.........................
s5	..........G....G....................

5 x 36 dna alignment

We specify the genetic code, and we allow incomplete codons. In this case, if a codon contains a gap, they are converted to ? in the translation.

nt_seqs.get_translation(gc=1, incomplete_ok=True)

	0
s2	THANSLQHENSS
s1	A..S......?.
s3	...S........
s4	...S........
s5	...S.V......

5 x 12 protein alignment

Translate DNA sequences#

from cogent3 import get_code

standard_code = get_code(1)
standard_code.translate("TTTGCAAAC")

'FAN'

Conversion to a ProteinSequence from a DnaSequence is shown in Translate a DnaSequence to protein.

Translate all six frames#

from cogent3 import get_code, make_seq

standard_code = get_code(1)
seq = make_seq("ATGCTAACATAAA", moltype="dna")
translations = standard_code.sixframes(seq)
print(translations)

['MLT*', 'C*HK', 'ANI', 'FMLA', 'LC*H', 'YVS']

Find out how many stops in a frame#

from cogent3 import get_code, make_seq

standard_code = get_code(1)
seq = make_seq("ATGCTAACATAAA", moltype="dna")
stops_frame1 = standard_code.get_stop_indices(seq, start=0)
stops_frame1

[9]

stop_index = stops_frame1[0]
seq[stop_index : stop_index + 3]

	0
None	TAA

DnaSequence, length=3

Translate a codon#

from cogent3 import get_code, make_seq

standard_code = get_code(1)
standard_code["TTT"]

'F'

or get the codons for a single amino acid

standard_code["A"]

['GCT', 'GCC', 'GCA', 'GCG']

Look up the amino acid corresponding to a single codon#

from cogent3 import get_code

standard_code = get_code(1)
standard_code["TTT"]

'F'

Get all the codons for one amino acid#

from cogent3 import get_code

standard_code = get_code(1)
standard_code["A"]

['GCT', 'GCC', 'GCA', 'GCG']

Get all the codons for a group of amino acids#

targets = ["A", "C"]
codons = [standard_code[aa] for aa in targets]
codons

[['GCT', 'GCC', 'GCA', 'GCG'], ['TGT', 'TGC']]

flat_list = sum(codons, [])
flat_list

['GCT', 'GCC', 'GCA', 'GCG', 'TGT', 'TGC']

Converting the `CodonAlphabet` to codon series#

from cogent3 import get_code

gc = get_code(1)
alphabet = gc.get_alphabet()
print(alphabet)

('TTT', 'TTC', 'TTA', 'TTG', 'TCT', 'TCC', 'TCA', 'TCG', 'TAT', 'TAC', 'TGT', 'TGC', 'TGG', 'CTT', 'CTC', 'CTA', 'CTG', 'CCT', 'CCC', 'CCA', 'CCG', 'CAT', 'CAC', 'CAA', 'CAG', 'CGT', 'CGC', 'CGA', 'CGG', 'ATT', 'ATC', 'ATA', 'ATG', 'ACT', 'ACC', 'ACA', 'ACG', 'AAT', 'AAC', 'AAA', 'AAG', 'AGT', 'AGC', 'AGA', 'AGG', 'GTT', 'GTC', 'GTA', 'GTG', 'GCT', 'GCC', 'GCA', 'GCG', 'GAT', 'GAC', 'GAA', 'GAG', 'GGT', 'GGC', 'GGA', 'GGG')

Obtaining the codons from a `DnaSequence` object#

Use the method get_in_motif_size

from cogent3 import make_seq

my_seq = make_seq("ATGCACTGGTAA", name="my_gene", moltype="dna")
codons = my_seq.get_in_motif_size(3)
codons

['ATG', 'CAC', 'TGG', 'TAA']

Translating a DNA sequence#

The defaults for get_translation() include using the standard genetic code and trimming a terminating stop if it exists.

pep = my_seq.get_translation()
pep

	0
my_gene	MHW

ProteinSequence, length=3

Translating a DNA sequence containing stop codons#

Making a sequence that contains both internal and terminating stop codons.

from cogent3 import make_seq

seq = make_seq("ATGTGATGGTAA", name="s1", moltype="dna")

Translating this will fail with default settings.

pep = seq.get_translation()

---------------------------------------------------------------------------
AlphabetError                             Traceback (most recent call last)
File ~/work/cogent3.github.io/cogent3.github.io/.venv/lib/python3.12/site-packages/cogent3/core/sequence.py:1796, in NucleicAcidSequence.get_translation(self, gc, incomplete_ok, include_stop, trim_stop)
   1795 try:
-> 1796     resolved = moltype.resolve_ambiguity(
   1797         orig_codon, alphabet=codon_alphabet
   1798     )
   1799 except AlphabetError:

File ~/work/cogent3.github.io/cogent3.github.io/.venv/lib/python3.12/site-packages/cogent3/core/moltype.py:1359, in MolType.resolve_ambiguity(self, ambig_motif, alphabet, allow_gap)
   1358 if not result:
-> 1359     raise AlphabetError(ambig_motif)
   1361 return result

AlphabetError: TGA

During handling of the above exception, another exception occurred:

AlphabetError                             Traceback (most recent call last)
Cell In[18], line 1
----> 1 pep = seq.get_translation()

File ~/work/cogent3.github.io/cogent3.github.io/.venv/lib/python3.12/site-packages/cogent3/core/sequence.py:1801, in NucleicAcidSequence.get_translation(self, gc, incomplete_ok, include_stop, trim_stop)
   1799 except AlphabetError:
   1800     if not incomplete_ok or "-" not in orig_codon:
-> 1801         raise AlphabetError(
   1802             f"unresolvable codon {orig_codon!r} in {self.name}"
   1803         )
   1804     resolved = (orig_codon,)
   1805 trans = []

AlphabetError: unresolvable codon 'TGA' in s1

Unless you explicitly allow stop codons

pep = seq.get_translation(include_stop=True)
pep

	0
s1	MW

ProteinWithStopSequence, length=4