Sequence

The Sequence object contains classes that represent biological sequence data. These provide generic biological sequence manipulation functions, plus functions that are critical for the evolve module calculations.

Warning

Do not import sequence classes directly! It is expected that you will access them through MolType objects. The molecular types can be accessed via the cogent3.get_moltype() function. Sequence classes depend on information from the MolType that is only available after MolType has been imported. Sequences are intended to be immutable. This is not enforced by the code for performance reasons, but don’t alter the MolType or the sequence data after creation.

DNA and RNA sequences

Creating a DNA sequence from a string

All sequence and alignment objects have a molecular type, or MolType which provides key properties for validating sequence characters. Here we use the DNA MolType to create a DNA sequence.

from cogent3 import DNA

my_seq = DNA.make_seq("AGTACACTGGT")
my_seq
print(my_seq)
str(my_seq)
AGTACACTGGT
'AGTACACTGGT'

Creating a RNA sequence from a string

from cogent3 import RNA

rnaseq = RNA.make_seq("ACGUACGUACGUACGU")

Converting to FASTA format

from cogent3 import DNA

my_seq = DNA.make_seq("AGTACACTGGT")
print(my_seq.to_fasta())
>0
AGTACACTGGT

Convert a RNA sequence to FASTA format

from cogent3 import RNA

rnaseq = RNA.make_seq("ACGUACGUACGUACGU")
rnaseq.to_fasta()
'>0\nACGUACGUACGUACGU\n'

Creating a named sequence

You can also use a convenience make_seq() function, providing the moltype as a string.

from cogent3 import make_seq

my_seq = make_seq("AGTACACTGGT", "my_gene", moltype="dna")
my_seq
type(my_seq)
cogent3.core.sequence.DnaSequence

Setting or changing the name of a sequence

from cogent3 import make_seq

my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq.name = "my_gene"
print(my_seq.to_fasta())
>my_gene
AGTACACTGGT

Complementing a DNA sequence

from cogent3 import DNA

my_seq = DNA.make_seq("AGTACACTGGT")
print(my_seq.complement())
TCATGTGACCA

Reverse complementing a DNA sequence

print(my_seq.rc())
ACCAGTGTACT

The rc method name is easier to type

print(my_seq.rc())
ACCAGTGTACT

Translate a DnaSequence to protein

from cogent3 import DNA

my_seq = DNA.make_seq("GCTTGGGAAAGTCAAATGGAA", "protein-X")
pep = my_seq.get_translation()
type(pep)
print(pep.to_fasta())
>protein-X
AWESQME

Converting a DNA sequence to RNA

from cogent3 import DNA

my_seq = DNA.make_seq("ACGTACGTACGTACGT")
print(my_seq.to_rna())
ACGUACGUACGUACGU

Convert an RNA sequence to DNA

from cogent3 import RNA

rnaseq = RNA.make_seq("ACGUACGUACGUACGU")
print(rnaseq.to_dna())
ACGTACGTACGTACGT

Testing complementarity

from cogent3 import DNA

a = DNA.make_seq("AGTACACTGGT")
a.can_pair(a.complement())
a.can_pair(a.rc())
True

Joining two DNA sequences

from cogent3 import DNA

my_seq = DNA.make_seq("AGTACACTGGT")
extra_seq = DNA.make_seq("CTGAC")
long_seq = my_seq + extra_seq
long_seq
str(long_seq)
'AGTACACTGGTCTGAC'

Slicing DNA sequences

my_seq[1:6]
0
NoneGTACA

5 DnaSequence

Getting 3rd positions from codons

The easiest approach is to work off the cogent3 ArrayAlignment object.

We’ll do this by specifying the position indices of interest, creating a sequence Feature and using that to extract the positions.

from cogent3 import DNA

seq = DNA.make_array_seq("ATGATGATGATG")
pos3 = seq[2::3]
assert str(pos3) == "GGGG"

Getting 1st and 2nd positions from codons

In this instance we can use the annotatable sequence classes.

from cogent3 import DNA

seq = DNA.make_seq("ATGATGATGATG")
indices = [(i, i + 2) for i in range(len(seq))[::3]]
pos12 = seq.add_feature("pos12", "pos12", indices)
pos12 = pos12.get_slice()
assert str(pos12) == "ATATATAT"

Return a randomized version of the sequence

print rnaseq.shuffle()
ACAACUGGCUCUGAUG

Remove gaps from a sequence

from cogent3 import RNA

s = RNA.make_seq("--AUUAUGCUAU-UAu--")
print(s.degap())
AUUAUGCUAUUAU