from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq.moltype.label'dna'Sequences
The Sequence object provides generic biological sequence manipulation functions, plus functions that are critical for the evolve module calculations.
Generic molecular types
Sequence properties are affected by the moltype you specify. The default type for a sequence is "text".
my_seq| 0 | |
| None | AGTACACTGGT |
DnaSequence, length=11
In some circumstances you can also have a "bytes" moltype, which I’ll explicitly construct here.
my_seq = make_seq("AGTACACTGGT", moltype="bytes")
my_seq.moltype.label'bytes'my_seq| 0 | |
| None | AGTACACTGGT |
ByteSequence, length=11
DNA and RNA sequences
Creating a DNA sequence from a string
Sequence properties are affected by the moltype you specify. Here we specify the DNA molecular type.
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq| 0 | |
| None | AGTACACTGGT |
DnaSequence, length=11
Creating a RNA sequence from a string
from cogent3 import make_seq
rnaseq = make_seq("ACGUACGUACGUACGU", moltype="rna")Converting to FASTA format
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq| 0 | |
| None | AGTACACTGGT |
DnaSequence, length=11
Convert a RNA sequence to FASTA format
from cogent3 import make_seq
rnaseq = make_seq("ACGUACGUACGUACGU", moltype="rna")
rnaseq| 0 | |
| None | ACGUACGUACGUACGU |
RnaSequence, length=16
Writing a sequence to file
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", name="seq1", moltype="dna")
my_seq.write("my_seq.fasta")Creating a named sequence
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", "my_gene", moltype="dna")
my_seq
type(my_seq)cogent3.core.sequence.DnaSequenceSetting or changing the name of a sequence
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq.name = "my_gene"
my_seq| 0 | |
| my_gene | AGTACACTGGT |
DnaSequence, length=11
Complementing a DNA sequence
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
my_seq.complement()| 0 | |
| None | TCATGTGACCA |
DnaSequence, length=11
Reverse complementing a DNA sequence
my_seq.rc()| 0 | |
| None | ACCAGTGTACT |
DnaSequence, length=11
Translate a sequence to protein
from cogent3 import make_seq
my_seq = make_seq("GCTTGGGAAAGTCAAATGGAA", name="s1", moltype="dna")
pep = my_seq.get_translation()
type(pep)cogent3.core.sequence.ProteinSequencepep| 0 | |
| s1 | AWESQME |
ProteinSequence, length=7
The default is to trim a terminating stop if it exists. If you set trim_stop=False and there is a terminating stop, an AlphabetError is raised.
from cogent3 import make_seq
my_seq = make_seq("ATGCACTGGTAA", name="my_gene", moltype="dna")
my_seq.get_translation(trim_stop=False)--------------------------------------------------------------------------- AlphabetError Traceback (most recent call last) Cell In[18], line 4 1 from cogent3 import make_seq 2 3 my_seq = make_seq("ATGCACTGGTAA", name="my_gene", moltype="dna") ----> 4 my_seq.get_translation(trim_stop=False) File ~/work/cogent3.github.io/cogent3.github.io/doc/cogent3/src/cogent3/core/sequence.py:2340, in NucleicAcidSequenceBase.get_translation(self, gc, incomplete_ok, include_stop, trim_stop) 2338 if not include_stop and "*" in pep: 2339 msg = f"{self.name!r} has a stop codon in the translation" -> 2340 raise c3_alphabet.AlphabetError(msg) 2342 if not incomplete_ok and "X" in pep: 2343 msg = ( 2344 f"{self.name!r} has an incomplete codon or contains an ambiguity, set incomplete_ok=True to " 2345 "allow translation" 2346 ) AlphabetError: 'my_gene' has a stop codon in the translation
You can also specify the genetic code.
my_seq.get_translation(gc="Vertebrate Mitochondrial") # or gc=2| 0 | |
| my_gene | MHW |
ProteinSequence, length=3
Translating a DNA sequence containing stop codons
By default, get_translation() will fail if there are any stop codons in frame in the sequence. You can allow translation in these cases by setting the optional argument include_stop=True.
from cogent3 import make_seq
seq = make_seq("ATGTGATGGTAA", name="s1", moltype="dna")
pep = seq.get_translation(include_stop=True)
pep| 0 | |
| s1 | M*W |
ProteinWithStopSequence, length=3
Converting a DNA sequence to RNA
from cogent3 import make_seq
my_seq = make_seq("ACGTACGTACGTACGT", moltype="dna")
rnaseq = my_seq.to_rna()
rnaseq| 0 | |
| None | ACGUACGUACGUACGU |
RnaSequence, length=16
Convert an RNA sequence to DNA
from cogent3 import make_seq
rnaseq = make_seq("ACGUACGUACGUACGU", moltype="rna")
dnaseq = rnaseq.to_dna()
dnaseq| 0 | |
| None | ACGTACGTACGTACGT |
DnaSequence, length=16
Testing complementarity
from cogent3 import make_seq
a = make_seq("AGTACACTGGT", moltype="dna")
a.can_pair(a.complement())Falsea.can_pair(a.rc())TrueJoining two DNA sequences
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
extra_seq = make_seq("CTGAC", moltype="dna")
long_seq = my_seq + extra_seq
long_seq| 0 | |
| None | AGTACACTGGTCTGAC |
DnaSequence, length=16
Getting all k-mers from a sequence
from cogent3 import make_seq
my_seq = make_seq("AGTACACTGGT", moltype="dna")
list(my_seq.iter_kmers(k=2))['AG', 'GT', 'TA', 'AC', 'CA', 'AC', 'CT', 'TG', 'GG', 'GT']
Note
By default, any k-mer that contains an ambiguity code is excluded from the output.
You can include ALL k-mers by setting strict=False.
my_seq = make_seq("AGTANACTGGT", moltype="dna")
list(my_seq.iter_kmers(k=2, strict=False))['AG', 'GT', 'TA', 'AN', 'NA', 'AC', 'CT', 'TG', 'GG', 'GT']Slicing DNA sequences
my_seq[1:6]| 0 | |
| None | GTANA |
DnaSequence, length=5
Obtaining the codons from a DnaSequence object
Use the method get_in_motif_size
from cogent3 import make_seq
my_seq = make_seq("ATGCACTGGTAA", name="my_gene", moltype="dna")
codons = my_seq.get_in_motif_size(3)
codons['ATG', 'CAC', 'TGG', 'TAA']Getting 3rd positions from codons
from cogent3 import make_seq
seq = make_seq("ATGATGATGATG", moltype="dna")
pos3 = seq[2::3]
assert str(pos3) == "GGGG"Getting 1st and 2nd positions from codons
In this instance we can use features.
from cogent3 import make_seq
seq = make_seq("ATGATGATGATG", moltype="dna")
indices = [(i, i + 2) for i in range(len(seq))[::3]]
pos12 = seq.add_feature(biotype="pos12", name="pos12", spans=indices)
pos12 = pos12.get_slice()
assert str(pos12) == "ATATATAT"Return a randomised version of the sequence
rnaseq.shuffle()| 0 | |
| None | AAGUGGCUUACCGUAC |
RnaSequence, length=16
Remove gaps from a sequence
from cogent3 import make_seq
s = make_seq("--AUUAUGCUAU-UAU--", moltype="rna")
s.degap()| 0 | |
| None | AUUAUGCUAUUAU |
RnaSequence, length=13
Getting GC% by counting states
We can obtain the percentage of GC nucleotides by using the counts method on sequences. This returns an object that behaves like a dictionary.
from cogent3 import make_seq
s = make_seq("ACCGTGACGA", moltype="dna")
counts = s.counts()
GC = counts["G"] + counts["C"]
GC_frac = GC / sum(counts.values())
GC_frac * 10060.0
Note
Other arguments on the counts() method allow including ambiguous or gap characters in the result.
Counting k-mers
A k-mer is a word of size \(k\) and, as is the convention, its counts are derived from all possible positions (as distinct from non-overlapping words which is how motif counts are calculated).
from cogent3 import make_seq
s = make_seq("ACCGTGACGA", moltype="dna")
kcounts = s.count_kmers(k=2)
kcountsarray([0, 0, 0, 1, 0, 1, 0, 2, 0, 2, 0, 0, 1, 0, 2, 0], dtype=uint64)In this case, the result is a numpy array with the order of elements corresponding to the result of
s.moltype.alphabet.get_kmer_alphabet(2)('TT',
'TC',
'TA',
'TG',
'CT',
'CC',
'CA',
'CG',
'AT',
'AC',
'AA',
'AG',
'GT',
'GC',
'GA',
'GG')
Note
We support third-party plugins for k-mer counting. After installing one, they can be selected by specifying the package with the .count_kmers(k=2, use_hook="<package name>").