from cogent3 import get_app
loader = get_app("load_unaligned", format_name="fasta")
seqs = loader("data/SCA1-cds.fasta")Using a nucleotide model
We load the unaligned sequences we will use in our examples.
We use an app loader, but since this is just a single file we could have used the cogent3.load_unaligned_seqs() function.
Nucleotide alignment with default settings
The default setting for “nucleotide” is a HKY85 model.
from cogent3 import get_app
nt_aligner = get_app("progressive_align", "nucleotide")
aligned = nt_aligner(seqs)
aligned| 0 | |
| Human | ATGAAATCCAACCAAGAGCGGAGCAACGAATGCCTGCCTCCCAAGAAGCGCGAGATCCCC |
| Chimp | ............................................................ |
| Macaque | ............................................................ |
| Rat | ........T.................T....................A..T......... |
| Mouse | ...............................................A..T......... |
| Mouse Lemur | ..................................................T......... |
6 x 2475 (truncated to 6 x 60) dna alignment
If you specify unique_guides=True, a guide tree will be estimated for every alignment.
Specify a different distance measure for estimating the guide tree
For the nucleotide case, you can use TN93 or paralinear.
nt_aligner = get_app("progressive_align", "nucleotide", distance="TN93")
aligned = nt_aligner(seqs)
aligned| 0 | |
| Human | ATGAAATCCAACCAAGAGCGGAGCAACGAATGCCTGCCTCCCAAGAAGCGCGAGATCCCC |
| Chimp | ............................................................ |
| Macaque | ............................................................ |
| Rat | ........T.................T....................A..T......... |
| Mouse | ...............................................A..T......... |
| Mouse Lemur | ..................................................T......... |
6 x 2475 (truncated to 6 x 60) dna alignment
Providing a guide tree
tree = "((Chimp:0.001,Human:0.001):0.0076,Macaque:0.01,((Rat:0.01,Mouse:0.01):0.02,Mouse_Lemur:0.02):0.01)"
nt_aligner = get_app("progressive_align", "nucleotide", guide_tree=tree)
aligned = nt_aligner(seqs)
aligned| 0 | |
| Human | ATGAAATCCAACCAAGAGCGGAGCAACGAATGCCTGCCTCCCAAGAAGCGCGAGATCCCC |
| Chimp | ............................................................ |
| Macaque | ............................................................ |
| Rat | ........T.................T....................A..T......... |
| Mouse | ...............................................A..T......... |
| Mouse Lemur | ..................................................T......... |
6 x 2475 (truncated to 6 x 60) dna alignment
The guide tree must have branch lengths, otherwise a ValueError is raised.
Specifying the substitution model
You can use any cogent3 nucleotide substitution model. For a list of all available, see cogent3.available_models().
tree = "((Chimp:0.001,Human:0.001):0.0076,Macaque:0.01,((Rat:0.01,Mouse:0.01):0.02,Mouse_Lemur:0.02):0.01)"
nt_aligner = get_app("progressive_align", "F81", guide_tree=tree)
aligned = nt_aligner(seqs)
aligned| 0 | |
| Human | ATGAAATCCAACCAAGAGCGGAGCAACGAATGCCTGCCTCCCAAGAAGCGCGAGATCCCC |
| Chimp | ............................................................ |
| Macaque | ............................................................ |
| Rat | ........T.................T....................A..T......... |
| Mouse | ...............................................A..T......... |
| Mouse Lemur | ..................................................T......... |
6 x 2475 (truncated to 6 x 60) dna alignment
Alignment settings provenance
The parameters used to construct the alignment, including the guide tree and substitution model, are record in the alignment info attribute.
aligned.info{'Refs': {},
'align_params': {'indel_length': 0.1,
'indel_rate': 1e-10,
'guide_tree': '((Chimp:0.001,Human:0.001):0.0076,(Macaque:0.01,((Rat:0.01,Mouse:0.01):0.02,Mouse_Lemur:0.02):0.01):1e-06);',
'model': 'F81',
'lnL': -6402.5569169915125}}
The file from which the alignment was derived (the provenance) is on the .source attribute.
aligned.source'SCA1-cds'