Loading aligned sequence data#

We can load aligned sequence data using the load_aligned app. When making the app, you can optionally provide arguments for the molecular type of the sequence and the format of the data.

Loading aligned DNA sequences from a single fasta file#

Here we load the brca1 gene in bats, providing the molecular type (moltype="dna") and file format (format_name="fasta").

from cogent3 import get_app

load_aligned_app = get_app("load_aligned", moltype="dna", format_name="fasta")
aln = load_aligned_app("data/brca1-bats.fasta")
aln
0
LittleBroTGTGGCACAGATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTACTACTCACC
FlyingFox.........A..G.............T...............---......T..TA...T
DogFaced.........A............A............................T..TA...T
FreeTaile...........................................................T
TombBat.........AG................G...............................T

5 x 3009 (truncated to 5 x 60) dna alignment

Loading aligned protein sequences from a single phylip file#

Here we load a globin alignment, providing the molecular type (moltype="protein") and file format (format_name="phylip").

from cogent3 import get_app

load_aligned_app = get_app("load_aligned", moltype="protein", format_name="phylip")
aln = load_aligned_app("data/abglobin_aa.phylip")
aln
0
goat-cowVLSAADKSNVKAAWGKVGGNAGAYGAEALERMFLSFPTTKTYFPHFDLSHGSAQVKGHGE
human...P...T..........AH..E....................................K
rabbit...P...T.I.T..E.I.SHG.E.....V.....G............FT...E.I.A..K
rat....D..T.I.NC...I..HG.E..E...Q...AA........S.I.V.P......A..K
marsupial...D...TH...I......H....A....A.T.................P....IQ...K

5 x 285 (truncated to 5 x 60) protein alignment

Loading aligned DNA sequences from multiple fasta files#

In the above examples, the result is a single alignment, which could have been achieved using standard cogent3 (load_aligned_seqs()). The real power of apps is for batch processing of a large number of files.

To apply apps to multiple files we need to set two things up:

1. A data store that identifies the files we are interested in#

Here, we create a data store containing all the files with the “.fasta” suffix in the data directory, limiting the data store to two members as a minimum example.

from cogent3 import open_data_store

fasta_seq_dstore = open_data_store("data", suffix="fasta", mode="r", limit=2)

2. A composed process that defines our workflow#

In this example, our process loads the sequences, filters the sequences to keep only the third codon position, and then writes the filtered sequences to a data store.

Note

Apps that are “writers” require a data store to write to, learn more about writers here!

from cogent3 import get_app, open_data_store

out_dstore = open_data_store(path_to_dir, suffix="fa", mode="w")

loader = get_app("load_aligned", format_name="fasta", moltype="dna")
cpos3 = get_app("take_codon_positions", 3)
writer = get_app("write_seqs", out_dstore, format_name="fasta")

process = loader + cpos3 + writer

Tip

When running this code on your machine, remember to replace path_to_dir with an actual directory path.

Now we’re good to go, we can apply process to our data store!#

result is a data store, which you can index to see individual data members - which are our alignments. We can take a closer look using the .read() method on data members (truncating to 50 characters).

result = process.apply_to(fasta_seq_dstore)
print(result[0].read()[:50])
{"type": "cogent3.app.composable.NotCompleted", "n