Loading aligned sequence data

We can load aligned sequence data using the load_aligned app. When making the app, you can optionally provide arguments for the molecular type of the sequence and the format of the data.

Loading aligned DNA sequences from a single fasta file

Here we load the brca1 gene in bats, providing the molecular type (moltype="dna") and file format (format_name="fasta").

from cogent3 import get_app

load_aligned_app = get_app("load_aligned", moltype="dna", format_name="fasta")
aln = load_aligned_app("data/brca1-bats.fasta")
aln
0
LittleBroTGTGGCACAGATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTACTACTCACC
FlyingFox.........A..G.............T...............---......T..TA...T
DogFaced.........A............A............................T..TA...T
FreeTaile...........................................................T
TombBat.........AG................G...............................T

5 x 3009 (truncated to 5 x 60) dna alignment

Loading aligned protein sequences from a single phylip file

Here we load a globin alignment, providing the molecular type (moltype="protein") and file format (format_name="phylip").

from cogent3 import get_app

load_aligned_app = get_app("load_aligned", moltype="protein", format_name="phylip")
aln = load_aligned_app("data/abglobin_aa.phylip")
aln
0
goat-cowVLSAADKSNVKAAWGKVGGNAGAYGAEALERMFLSFPTTKTYFPHFDLSHGSAQVKGHGE
human...P...T..........AH..E....................................K
rabbit...P...T.I.T..E.I.SHG.E.....V.....G............FT...E.I.A..K
rat....D..T.I.NC...I..HG.E..E...Q...AA........S.I.V.P......A..K
marsupial...D...TH...I......H....A....A.T.................P....IQ...K

5 x 285 (truncated to 5 x 60) protein alignment

Loading aligned DNA sequences from multiple fasta files

In the above examples, the result is a single alignment, which could have been achieved using standard cogent3 (load_aligned_seqs()). The real power of apps is for batch processing of a large number of files.

To apply apps to multiple files we need to set two things up:

1. A data store that identifies the files we are interested in

Here, we create a data store containing all the files with the “.fasta” suffix in the data directory, limiting the data store to two members as a minimum example.

from cogent3 import open_data_store

fasta_seq_dstore = open_data_store("data", suffix="fasta", mode="r", limit=2)

2. A composed process that defines our workflow

In this example, our process loads the sequences, filters the sequences to keep only the third codon position, and then writes the filtered sequences to a data store.

Note

Apps that are “writers” require a data store to write to, learn more about writers here!

from cogent3 import get_app, open_data_store

out_dstore = open_data_store(path_to_dir, suffix="fa", mode="w")

loader = get_app("load_aligned", format_name="fasta", moltype="dna")
cpos3 = get_app("take_codon_positions", 3)
writer = get_app("write_seqs", out_dstore, format_name="fasta")

process = loader + cpos3 + writer
Tip

When running this code on your machine, remember to replace path_to_dir with an actual directory path.

Now we’re good to go, we can apply process to our data store!

result is a data store, which you can index to see individual data members - which are our alignments. We can take a closer look using the .read() method on data members (truncating to 50 characters).

result = process.apply_to(fasta_seq_dstore)
print(result[0].read()[:50])
>human
CCCGCAGCAGGGTGTCGCCGTCCTTTTCACGGCTAGTAAATAG